Bacillus Coagulans Bc: Gastrointestinal Issues
An RCT investigated the effect of B. coagulans BC30 in 44 individuals with IBS-D confirmed by the Rome II IBS diagnostic criteria. Individuals were divided to receive either 0.8 billion CFU of B. coagulans BC30 or placebo daily for eight weeks. Participants recorded severity of abdominal pain and bloating every day during the intervention period. At the end of the study, those in the probiotic group had significantly reduced abdominal pain and bloating. Weekly analysis suggested that the probiotic was effective in reducing abdominal pain and bloating after one weeks supplementation, with improved overall symptom scores compared to placebo . Placebo supplementation also resulted in significant reductions in abdominal pain at week six and week eight but no other weeks reached significance. Overall these results show potential for B. coagulans BC30 to support those with IBS related abdominal pain and bloating .
Graph 1
A similarly designed RCT found B. coagulans BC30 to significantly improve symptoms in participants with diagnosed IBS-D. The trial included 52 individuals who were divided to receive probiotic or placebo once a day for eight weeks. In the probiotic group, the average number of bowel movements significantly reduced compared to placebo, highlighting the strains ability to support healthy bowel movements .
What Is A Probiotic Strain
When you see a probiotic listed on a product label, it should contain three different names. These include the genus, species, and strain of the probiotic. Check out the image below to see the different parts of a probiotic name.
Unfortunately, most probiotic supplements on the market only tell you up to the species level, so instead of the label reading Bacillus coagulans GBI-30 6086, it would only say Bacillus coagulans.
While you might think thats no big deal, its actually a very big deal.
Thats because probiotic effects are strain-specific — that means that one probiotic strain might act in a completely different way than another strain of the same species.
Biocontrol Of Listeria Monocytogenes By Bacillus Coagulans Gbi
Challenge trials enable estimation of the growth potential of the pathogen in cheese during storage.
-
Effect of Bacillus coagulans GBI-30,6086 on Listeria monocytogenes was examined on white cheese.
-
Bacillus coagulans GBI-30,6086 survived in cheese and after simulated gastrointestinal condition .
-
Bacillus coagulans GBI-30, 6086 presented mild inhibitory outcome on L. monocytogenes in cheese and after SGC.
You May Like: Rainbow Light Women’s One Plus Superfoods And Probiotics
How Do They Survive What About Refrigeration
Many lactic acid bacterium, like those found in yogurt, do require refrigeration to maintain viability. But the probiotics in our granola are spore-forming microorganisms, meaning the organism is naturally capable of forming a dormant spore which protects the genetic core of the cell for long periods of time. That dormant spore will not germinate and reproduce until it is in an environment of 30 degrees Celsius with available water and food. Cool huh?
So this spore-forming quality keeps the probiotics dormant through the manufacturing processes, a 3 year shelf life, and low pH and bile salts of the gastric transit. THEN once it hits the digestive system, where the moisture, food source, and temperature conditions are just right, it comes out and germinates, providing benefits to that belly.
Supporting Gut Health With Bc30
BC30 is a highly stable spore-forming probiotic ingredient that can be formulated into food and beverage products. With BC30, consumers who are used to finding probiotics in traditional formats such as yoghurt can receive the benefits of probiotics in a wide range of products that fit their daily routines and dietary preferences.
You May Like: How Long Until Probiotics Start Working
What To Look For
B. coagulans is sold as a stand-alone supplement or in combination with other probiotics. If purchasing a broad-spectrum probiotic, read the label to ensure it contains B. coagulans.
Dietary supplements are not regulated by the U.S. Food & Drug Administration . To make sure you are buying a quality probiotic, look for a trusted, independent third-party seal on the label, such as U.S. Pharmacopeia, NSF International, and ConsumerLab. This does not guarantee safety or efficacy, but it can reassure you that what’s advertised on the label is what you’re getting.
Effect On Bacterial Populations And Scfa Production
F. prausnitzii populations were significantly greater in volunteers who consumed BC30 than volunteers who consumed the placebo . In response to the consumption of BC30, Bacillus spp. showed a significant increase population from baseline however, the overall effect of BC30 consumption was not significantly greater than that seen during consumption of the placebo. No other bacterial groups showed any changes . Fecal SCFA significantly increased from baseline in response to both treatments during the study however, neither treatment elicited a greater response than the other .
Changes in bacterial populations in fecal microbiota of older volunteers who were administered the probiotic Bacillus coagulans BC30 and a placebo for 28 d each
| . |
|---|
Analysis of gas-related symptoms during both treatments showed no differences between the 2 interventions . In addition, no effects on mood or consistency of stool samples were found throughout the study.
You May Like: Probiotic Diet For Weight Loss
Why We Use Bacillus Coagulans Gbi
So why did we choose Bacillus coagulans GBI-30 6086?
Well, we wanted something that was specifically beneficial for both digestive and immune health. In addition to that, we knew we wanted a probiotic strain that was heat-stable so that you could make our drinks hot or cold and still enjoy the benefits of taking a live probiotic.
That led us to Bacillus coagulans GBI-30 6086!
Bacillus coagulans GBI-30 6086 has been clinically-studied and proven to support both digestive and immune health when taken in conjunction with a healthy diet and lifestyle.
But dont just take our word for it — check out the research section below to see the latest research on this special strain!
Bacillus Coagulans Bc: Safety And Survival
B. coagulans BC30 has been deemed safe for human consumption. An in vitro study assessed numerous toxicological parameters which confirmed the strain was safe and did not demonstrate any mutagenic, clasogenic, or genotoxic effects .
The strain has also been shown to be safe in several randomised clinical trials . They highlighted no significant differences in adverse events between probiotic and placebo groups .
An in vitro upper gastro intestinal tract model found B. coagulans BC30 showed high survival rates through the stomach and reached the small intestine. Germination rates were lower than expected, however the researchers note this was likely due to conditions tested and may not represent germination levels in vivo .
You May Like: Best Probiotic For Child Constipation
Orange Juice And Yogurt Carrying Probiotic Bacillus Coagulans Gbi
- 1Department of Food Science and Nutrition, Faculty of Food Engineering, University of Campinas, Campinas, Brazil
- 2Institute of Biosciences, Department of General and Applied Biology, São Paulo State University , Rio Claro, Brazil
- 3Laboratory of Microbial Processes in Food, Department of Food Engineering, Technology Center, Federal University of Paraíba, João Pessoa, Brazil
- 4Department of Physical Education, Federal University of Great Dourados, Dourados, Brazil
- 5Research Informatics Core, Research Resource Center, University of Illinois at Chicago, Chicago, IL, United States
- 6Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture , University of Campinas, Campinas, Brazil
- 7Internal Medicine Department, Faculty of Medical Sciences, University of Campinas, Campinas, Brazil
Effect On Nk Cell Activity
Effector cells used to determine NK cell activity were mononuclear cells that were separated from heparinized blood target cells were K562 cells. NK cell activity measured at each ratio of effector to target cells showed no significant differences between consumption of BC30 and placebo or significant changes between baseline and 28 d of treatment .
You May Like: What Probiotics Make You Gain Weight
Bacillus Coagulans Bc: Exercise And Muscular Integrity
Limited research has been conducted into the use of probiotics to support with athletic performance however, researchers have investigated this area with B. coagulans BC30 and found encouraging results.
A study included 29 males with at least three months of recreational training. The study lasted seven weeks in total which included a wash out period. Individuals received 20g casein daily for the first two weeks and then underwent exercise and testing. After a one-week washout, participants then received 20g casein daily plus one billion CFU of B. coagulans BC30 for two weeks followed by exercise and testing. B. coagulans BC30 consumption resulted in:
Increased recovery at 24hrs and 72hrs post exercise
Reduced muscle soreness at 72hrs
No significant differences were noted in performance measures between probiotic and control supplementation. However, the use of the probiotic did help to maintain physical performance. Overall, the probiotic could be used by athletes and other exercise goers to reduce muscle soreness and increase recovery rates .
A small pilot study including 10 men undergoing four body workouts per week found the use of B. coagulans BC30 to moderately improve jump power over an eight week study period .
Information on this strain was gathered by Dr Kate Stephens PhD Food and Microbial Sciences Gut Microbiology , BSc Medical Microbiology.
For more information and the latest research on probiotics, please visit the Probiotic Professionals pages.
Amino Acids Area Under The Curve
As seen in Table , the addition of BC30 led to significantly greater area under the curve values for all measured amino acids except for citrulline, asparagine, histidine, glutamic acid, and tryptophan. AUC values for arginine and isoleucine were significantly greater in MPCBC30 and tended to be greater for phenylalanine . Alternatively, glutamic acid tended to be greater in MPC .
Table 3 Individual amino acids, total BCAA, total EAA, and total amino acid area under the curve
Also Check: Is Green Tea A Probiotic
Bc30tm Helps Support Your Health
BC30TM is a highly efficacious and safe spore-forming probiotic with research backed digestive health, immune support and protein absorption benefits. Used by product makers to create probiotic-fortified products, functional foods and beverages that contain BC30 are widely available around the world, making it easier than ever to fuel your entire day with the health benefits of probiotics.
Innovation With A Spore
Its clear that theres a growing understanding of probiotics benefits all over the world. Theres still work to do, though. For example, theres a common misconception that all probiotic strains are the same, but the functionality and benefits can vary hugely. While some strains need to be kept in specific conditions, spore-forming probiotics like BC30 are extremely hardy and can be used in anything from ice cream to hot coffee and remain effective. Also, research shows BC30 not only benefits digestive health but also supports the immune system and assists protein utilization. Its important for us to improve consumer awareness and understanding of these differences. Play video to learn more.
Also Check: Gerber Soothe Probiotic Colic Drops
Enumeration Of Fecal Microbiota
Fluorescence in situ hybridization was performed according to Rycroft et al. . DNA oligonucleotide probes used were Bif164 , LAB158 , EREC482 , CLIT135 , BAC303 , Fprau645 , and Bcoa191 . The fluorescent DNA stain 4,6-diamidino-2-phenylindole dihydrochloride was used to detect total bacteria . All counts are presented as log10 cells/mL sample.
Gimme More The Immune System
Since 70% of your immune system is housed within the digestive system, a healthy digestive system is clearly going to also benefit the immune system. We want to create an optimal environment for the immune system to function.
So be good to your gut grab a bag of Purely Elizabeth Probiotic Granola and eat a serving OR TWO! Also you can check out our Gut Healthy Shopping List from our Purely Winter Magazine for other probiotic suggestions.
Thanks for letting us talk nerdy to you ) If there are any other nutrition questions you have leave a comment! Maybe itll inspire another science lesson post.
Read Also: Probiotics And Prebiotics For Women
Purely Nutrition School // What Probiotics Are Really Good For
We love probiotics here at Purely Elizabeth! So much so, we added them to some of our granolas: Chocolate Sea Salt + Maple Walnut. Youve probably heard that probiotics are good for you. They do something good for your gut/digestive system But what does that actually mean?
Well buckle up, we are headed to Nutrition School. Here are the ACTUAL benefits and the science behind probiotics.
S Rrna Gene Sequencing
A total of 21,466.032 reads were generated from the Next-Generation Sequencing of amplicons corresponding to the V3V4 region of the bacterial 16S rRNA gene. A total of 19.771.488 reads passed the sequence quality filters applied through the Trimmomatic software, with an average value of 681.775 reads per sample after the quality filtering was obtained . The alpha-diversity and richness through the number of ace, Chao1, Goods estimated sample coverage , OTUs, and Shannon and Simpson indices were obtained for all the samples .
Table 3. Alpha-diversity metrics , OTUs, Shannon and Simpson indices) obtained for fecal samples of healthy Wistar male rats after 21 days of administration of probiotic yogurt and probiotic juice inferred from the sequencing of 16S V3V4 amplicons.*
Figure 1. Principal coordinate analysis of jackknifed unweighted UniFrac distances for the 16S rRNA gene sequence data. Groups were as follows: Control: received distilled water Juice: received orange juice Yogurt: received yogurt probiotic Bacillus: received B. coagulans GBI-30 6086 suspended in distilled water Probiotic Juice: received orange juice with B. coagulans GBI-30 6086 and Probiotic Yogurt: received yogurt with B. coagulans GBI-30 6086.
Recommended Reading: Which Is Best Probiotics Or Prebiotics
Gut Microbiota Ecology Analysis
Total DNA was extracted from the cecal contents with the QIAmp DNA Stool Kit. For profiling microbiome composition, the hyper-variable region of the bacterial 16S rRNA gene was amplified using the Illumina 16S Metagenomic Sequencing Library Preparation guide Illumina 16S metagenomic sequencing library preparation , which uses the following sequence: 338F – 5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTA CGGGNGGCWGCAG -3 and 785R – 5′- GTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC -3′. Using 300 bp paired readings and MiSeq v3 reagents, each laws ends were overlaid to generate high-quality complete readings of the V3 and V4 regions. More than 100,000 readings per sample were generated, commonly recognized as sufficient for metagenomic research. The sequencing was performed in the Illumina Miseq equipment .
Bc30 And Protein Absorption Benefits
With the explosive growth of the sports nutrition market, BC30s unique bacterial strain may play a positive role in the use of protein for muscle repair and human recovery. BC30 can readily be paired with high-protein goods to offer optimized and nutritious food options.
BC30 may also support protein absorption. This may also enhance recovery after strenuous exercise and facilitate nutrient absorption.
Recommended Reading: Do Probiotics Help With Yeast Infections
Experimental Design Using Wistar Rats
The Ethical Commission previously approved all experimental procedures on Animal Use . A total of 48 male Wistar rats at 21 days were obtained from the Animal Breeding Center , and were used in the study. The animals were kept in individual cages under a specific condition with food and water provided ad libitum for adaptation during 3 weeks. The animals were randomly distributed into six groups of eight animals as follows: Control group, which received sterile distilled water Juice, which received orange juice Yogurt, which received yogurt Probiotic Bacillus, which received B. coagulans GBI-30 6086 suspended in distilled water Probiotic Juice, which received orange juice with B. coagulans GBI-30 6086 and Probiotic Yogurt, which received yogurt with B. coagulans GBI-30 6086.
All animal groups received a volume of four milliliters of liquid daily administered by orogastric gavage during 21 days. The administred volume was defined considering the volume of 1 ml/100 g according to the official protocols .
Customer Ratings And Reviews
There are no reviews yet! You can review this Business and help others by leaving a comment. If you want to share your thoughts about ALJ Electric, use the form below and your opinion, advice or comment will appear in this space.
Write a Review
- Electrician | Point of interest | Establishment14 Coventry Ct, Richmond Hill, ON L4C 8B8, Canada
- 10676 Bayview Ave, Richmond Hill, ON L4C 3N9, Canada
Don’t Miss: Best Probiotic For Weight Loss 2020
Gimme More The Digestive System:
Your digestive system powers your entire body. Its home to 70% of your immune system, and its where nutrients, vitamins and minerals are absorbed. Its two essential functions are:
Those two functions help keep us healthy and feeling our best! A proper balance of good vs. bad bacteria will allow the digestive system to perform these functions smoothly. Remember adding probiotics to your diet helps with that balance!
Increasing Muscle Health In Athletes: Reduced Exercise
Skeletal muscle mass is the sum of muscle protein breakdown and muscle protein synthesis . The protein kinase mechanistic target of rapamycin has been widely recognized as a key regulator of MPS and muscle mass. Mechanical stimulation of mTOR through weight-bearing exercise, or dietary activation through protein ingestion both stimulate MPS and are additive when protein consumption follows exercise. The recommended daily protein intake to maintain nitrogen balance is 0.8 g protein/kg body weight/day, however, people trying to increase muscle mass should increase their daily protein intake to 1.42.0 g protein/kg body weight/day. Optimal protein intake per serving for people trying to maximize MPS are 2025 g of a high-quality protein, containing 23 g of leucine, to be consumed every 34 h. Ingestion of higher amounts of protein does not further stimulate MPS. Rapidly digested proteins that contain high proportions of essential amino acids , of which the key amino acid appears to be leucine, are more effective in stimulating MPS than other proteins .
Co-administration of 20 g casein and 500 million CFU BC30 twice daily tended to increase vertical jump peak power over casein alone following an 8-week resistance training program
Study design investigating the effects of B. coagulans GBI-30, 6086 following a muscle-damaging exercise
You May Like: Probiotic For Digestive Health Supplement
